If one strand of DNA contains the sequence “ATCGCGTAACATGGATTCGG”, what will be the sequence of the complementary strand using the standard convention?
Get More
Subject Mock Tests
Practice with over 200,000 questions from various medical subjects and improve your knowledge.
Attempt a mock test nowMock Exam
Take an exam with 100 random questions selected from all subjects to test your knowledge.
Coming SoonGet More
Subject Mock Tests
Try practicing mock tests with over 200,000 questions from various medical subjects.
Attempt a mock test now