If one strand of DNA contains the sequence “ATCGCGTAACATGGATTCGG”, what will be the sequence of the complementary strand using the standard convention?
If one strand of DNA contains the sequence “ATCGCGTAACATGGATTCGG”, what will be the sequence of the complementary strand using the standard convention?
💡 Explanation
If one strand of DNA contains the sequence "ATCGCGTAACATGGATTCGG", what will be the sequence of the complementary strand using the standard convention?
✓ Correct Answer: B. CCGAATCCATGTTACGCGAT
📤 Share this MCQ
Share Card Preview
👆 1080x1080 square card — fills the full width in WhatsApp and Telegram