8317 Biochemistry Which of the following phospholipid serves as a marker of apoptosis APhosphatidylinositalBPhosphatidyl serine (Correct Answer)CPhosphatidyl cholineDPhosphatidyl ethanolamine
8318 Biochemistry Which enzyme level is tested in thiamine deficiency? APDHBPyruvate kinaseCTransketolase (Correct Answer)DKinase
8319 Biochemistry Inositic acid is biological precursor of ? AUracil and thymineBPurines and thy mineCAdenylic acid and guanylic acid (Correct Answer)DOrotic acid and uridylic acid
8321 Biochemistry All of the following are haemoproteins, EXCEPT: ACatalaseBTryptophan pyrrolaseCCytochrome cDAdenylate kinase (Correct Answer)
8322 Biochemistry Biosynthesis of glucuronic acid requires the AOxidation of UDP glucose (Correct Answer)BOxidation of glucose 6-phosphateCOxidation of 6-phophoguconateDOxidanation of glucose
8323 Biochemistry Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr? AA frameshift mutation resulted in the deletion of several amino acid residues in the b-chainBA mutation in the stop codon resulted in elongation of the b-chainCA point mutation resulted in the inseion of a stop codon in the b-chainDA two base pair addition resulted in the elimination of a stop codon in the b-chain (Correct Answer)
8324 Biochemistry Characteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition AbBcCacDad (Correct Answer)
8325 Biochemistry Atherosclerosis is due to AHDL receptor defectBApo protein E deficiency (Correct Answer)CDecreased LDL activityDDecreased lipoprotein lipase