All Subjects Medicine Surgery Pathology Anatomy Pharmacology Social & Preventive Medicine Microbiology Gynaecology & Obstetrics Dental Physiology Biochemistry Pediatrics
Showing 8498 questions
Sort:
8323 Biochemistry

Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?

AA frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
BA mutation in the stop codon resulted in elongation of the b-chain
CA point mutation resulted in the inseion of a stop codon in the b-chain
DA two base pair addition resulted in the elimination of a stop codon in the b-chain
Biochemistry
View Explanation →