Mcq Subject: Biochemistry

All of the following are haemoproteins, EXCEPT:

A. Catalase

B. Tryptophan pyrrolase

C. Cytochrome c

D. Adenylate kinase

View Description
Biosynthesis of glucuronic acid requires the

A. Oxidation of UDP glucose

B. Oxidation of glucose 6-phosphate

C. Oxidation of 6-phophoguconate

D. Oxidanation of glucose

View Description
Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?

A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain

B. A mutation in the stop codon resulted in elongation of the b-chain

C. A point mutation resulted in the inseion of a stop codon in the b-chain

D. A two base pair addition resulted in the elimination of a stop codon in the b-chain

View Description
Characteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition

A. b

B. c

C. ac

D. ad

View Description
Atherosclerosis is due to

A. HDL receptor defect

B. Apo protein E deficiency

C. Decreased LDL activity

D. Decreased lipoprotein lipase

View Description
For polymerase chain reaction which of the following is not required

A. TAQ polymerase

B. d-NTP

C. Dideoxynucleotides

D. Magnesium

View Description
Vitamin required for hydroxyproline to proline conversion:

A. Vitamin C

B. Vitamin E

C. Pvrodoxal PO4

D. Biotin

View Description
In all of the following enzyme deficiencies, hyperammonemia is a common feature, EXCEPT:

A. Argininosuccinate synthetase

B. Carbamoyl Phosphate synthetase (CPS-I)

C. Ornithine transcarbamoylase (OTC)

D. Ornithine amino transferase

View Description
Which of the following statements about High Density Lipoprotein (HDL) is false:

A. HDL increases oxidation of LDL

B. HDL reduces foam cell production by LDL

C. HDL is the best predictor of CAD

D. HDL helps to clear lipids from atheromas

View Description
RNA polymerase is

A. DNA dependent RNA polymerase

B. RNA dependent DNA polymerase

C. DNA dependent DNA polymerase

D. RNA dependent RNA polymerase

View Description
Get More
Subject Mock Tests

Practice with over 200,000 questions from various medical subjects and improve your knowledge.

Attempt a mock test now
Mock Exam

Take an exam with 100 random questions selected from all subjects to test your knowledge.

Coming Soon
Get More
Subject Mock Tests

Try practicing mock tests with over 200,000 questions from various medical subjects.

Attempt a mock test now
Mock Exam

Attempt an exam of 100 questions randomly chosen from all subjects.

Coming Soon