Mcq Subject: Biochemistry
All of the following are haemoproteins, EXCEPT:
A. Catalase
B. Tryptophan pyrrolase
C. Cytochrome c
D. Adenylate kinase
View DescriptionBiosynthesis of glucuronic acid requires the
A. Oxidation of UDP glucose
B. Oxidation of glucose 6-phosphate
C. Oxidation of 6-phophoguconate
D. Oxidanation of glucose
View DescriptionHemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
B. A mutation in the stop codon resulted in elongation of the b-chain
C. A point mutation resulted in the inseion of a stop codon in the b-chain
D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
View DescriptionCharacteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition
A. b
B. c
C. ac
D. ad
View DescriptionAtherosclerosis is due to
A. HDL receptor defect
B. Apo protein E deficiency
C. Decreased LDL activity
D. Decreased lipoprotein lipase
View DescriptionFor polymerase chain reaction which of the following is not required
A. TAQ polymerase
B. d-NTP
C. Dideoxynucleotides
D. Magnesium
View DescriptionVitamin required for hydroxyproline to proline conversion:
A. Vitamin C
B. Vitamin E
C. Pvrodoxal PO4
D. Biotin
View DescriptionIn all of the following enzyme deficiencies, hyperammonemia is a common feature, EXCEPT:
A. Argininosuccinate synthetase
B. Carbamoyl Phosphate synthetase (CPS-I)
C. Ornithine transcarbamoylase (OTC)
D. Ornithine amino transferase
View DescriptionWhich of the following statements about High Density Lipoprotein (HDL) is false:
A. HDL increases oxidation of LDL
B. HDL reduces foam cell production by LDL
C. HDL is the best predictor of CAD
D. HDL helps to clear lipids from atheromas
View DescriptionRNA polymerase is
A. DNA dependent RNA polymerase
B. RNA dependent DNA polymerase
C. DNA dependent DNA polymerase
D. RNA dependent RNA polymerase
View DescriptionGet More
Subject Mock Tests
Practice with over 200,000 questions from various medical subjects and improve your knowledge.
Attempt a mock test nowMock Exam
Take an exam with 100 random questions selected from all subjects to test your knowledge.
Coming SoonGet More
Subject Mock Tests
Try practicing mock tests with over 200,000 questions from various medical subjects.
Attempt a mock test now