Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
Correct Answer: A two base pair addition resulted in the elimination of a stop codon in the b-chain
Description: Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e.
Category:
Biochemistry
Get More
Subject Mock Tests
Practice with over 200,000 questions from various medical subjects and improve your knowledge.
Attempt a mock test nowMock Exam
Take an exam with 100 random questions selected from all subjects to test your knowledge.
Coming SoonGet More
Subject Mock Tests
Try practicing mock tests with over 200,000 questions from various medical subjects.
Attempt a mock test now